Operon: No data
| ftsZ |
SCO2082 |
SC4A10.15c, ftsZ |
- |
2234421..2235620 |
cell division protein |
Promoters
| Unknown_sigma |
ftsZ-p1 |
Promoter |
-50:+10 |
2235725..2235784 |
TTCGGAAGAGTCCAAGGAACAGACACACTGGTAACCCTAAACTTCAGCGTTAGGGTTCGG |
Flardh K, et al. (2000): S1
|
| HrdB? |
ftsZ-p2 |
Promoter |
-50:+10 |
2235774..2235833 |
GGTTCGGCGTGTTCGTTGAACGTGCGCCACTTGTCGACTTAGTGTCCTGTTCGGAAGAGT |
Flardh K, et al. (2000): S1
|
| Unknown_sigma |
ftsZ-p3 |
Promoter |
-50:+10 |
2235831..2235890 |
AGCACCCTGGTTGGGCAGCGCTACGGCTGATCACATAGGGTGAAAAGAAAAACGGGAGGT |
Flardh K, et al. (2000): S1
|
| WhiA |
ftsZ-p2 |
Positive |
ND |
ND |
ND |
Flardh K, et al. (2000): S1
|
| WhiB |
ftsZ-p2 |
Positive |
ND |
ND |
ND |
Flardh K, et al. (2000): S1
|
| WhiH |
ftsZ-p2 |
Positive |
ND |
ND |
ND |
Flardh K, et al. (2000): S1
|
| WhiI |
ftsZ-p2 |
Positive |
ND |
ND |
ND |
Flardh K, et al. (2000): S1
|
| WhiG |
ftsZ-p2 |
Positive |
ND |
ND |
ND |
Flardh K, et al. (2000): S1
|
| WhiJ |
ftsZ-p2 |
Positive |
ND |
ND |
ND |
Flardh K, et al. (2000): S1
|
| SsgA |
- |
Negative |
ND |
ND |
ND |
Noens EE, et al (2007): AR, RT-PCR
|
| BldD |
- |
Negative |
-257:-217(from translation start site) |
2235838..2235877 |
GGCAGCGCTACGGCTGATCACATAGGGTGAAAAGAAAAAC |
den Hengst CD, et al. (2010): AR, CH, FT, HM
|
| Comments:
|
| HrdB? |
The ftsZ-p2 promoter is required for sporulation septation. |
| BldD |
The BldD regulon encompasses ~167 transcriptional units, of which more than 20 are known to play important roles in development (e.g. bldA, bldC, bldH/adpA, bldM, bldN, ssgA, ssgB, ftsZ, whiB, whiG, smeA-ssfA) and/or secondary metabolism (e.g. nsdA, cvn9, bldA, bldC, leuA). Strikingly, 42 BldD target genes (~25% of the regulon) encode regulatory proteins, stressing the central, pleiotropic role of BldD. |
Terminator
No Data
Overview
|
|