DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

sasR

Operons: sasR

Genes	Gene ID	Synonyms	Direction	Genome position	Function
sasR	SGR_4456		+	5215074..5215949	putative RpiR-family transcriptional regulator

Operon evidence:	S1 promoter analysis for sasR, downstream gene is on the opposite strand
Reference:	Takano H,et al. (2008)

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
Unknown_sigma	-	Promoter	`-50:+10`	5215011..5215070	`CCTACCCCCTGCATATGGACATACAGCGACCTTCCTGGCTGAATAGAACGGTCGGCGCCG`	Takano H,et al. (2008): S1

No Data