DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

sgiA

Operons: sgiA

Genes	Gene ID	Synonyms	Direction	Genome position	Function
sgiA	SGR_551		-	634097..634540	protease inhibitor

Operon evidence:	Genome analysis; both upstream and downstream genes are on the opposite strand
Reference:

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
AdpA	-	Positive	`-100:-51`	634624..634673	`GAGCTGCCCGAATGACCATTCGGTCGGCTCGAACGCCCGCCCGCGGCTGG`	Hirano S, et al. (2006): GS, DB
Unknown_sigma	-	Promoter	`-50:+20`	634554..634623	`AAGGCGGCCGTCGGCGTGCGCTTACTTTCCGCATGCGTAAGACTCCTGACCGCAATCAGGCATTCGACCA`	Hirano S, et al. (2006): S1

No Data