Transcription factor: SrrY
| GenBank ID |
no data |
| Factor type |
ND |
| Pfam |
None |
| Consensus seq. |
ND |
| Comment |
The SrrY protein was specifically bound to the promoter region of srrZ, where a possible SARP binding sequence was identified 26 bp upstream of the -10 sequence. Deletion of the repeat sequences from this region abolished its SrrY binding activity. In addition, complementation of srrZ restored lankamycin production in the srrY mutant. All of these results confirm that the SARP gene srrY directly regulates expression of the second SARP gene srrZ in a positive manner. |
| srrZ |
None |
Positive |
-108:-24 |
GCGGTGGTTCGCCGGACCGGGCGGGGGAGCGCCGCTTCCGCTTGGAGTGGGGCTCGAACGGCGGTGGAGATACCGGAGCCGGAC |
Suzuki T, et al. (2010): HM, S1, DB, DP, OV, GS
|
S. rochei |
|