Operon: No data
| redZ |
SCO5881 |
|
- |
6438206..6438859 |
response regulator |
Promoters
| AbsA2 |
- |
Negative |
ND |
ND |
ND |
McKenzie NL, et al. (2007): ChIP, DB, GS
|
| RedZ |
- |
Negative |
ND |
ND |
ND |
White J, et al. (1997): S1, DB
|
| Unknown_sigma |
- |
Promoter |
-50:+10 |
6438962..6439021 |
CCTCGCAAGCCCCTCTCCAAGTGTGCACACGCGTGCTAAGTTTGGCCGCATGAGGCATAT |
Guthrie EP, et al. (1998): S1
|
| WblA |
- |
Negative |
ND |
ND |
ND |
Kang SH, et al. (2007): AR, OV(RT-PCR)
|
| DasR |
- |
Negative |
-212:-172(from translation start site) |
6439032..6439071 |
ACAAGATCTTCTTGAGGTGGAAACCACTTCGTATCAGTCT |
Rigali S, et al. (2008): HM, GS, sqRT-PCR
|
| SCO1712 |
- |
Negative |
ND |
ND |
ND |
Lee HN, et al. (2010): DB, OV(by RT-PCR)
Kang SH, et al. (2007): AR
|
| Comments:
|
| DasR |
The dre site upstream from redZ is situated about 50 bp upstream from the -35 sequence of the redZ promoter. DasR bound to the dre elements for the actII-ORF4, redZ and crr-ptsI promoter regions, but not to the cis-acting element of Crp. Semiquantitative reverse transcription-PCR (RT-PCR) analyses further showed upregulation of actII-ORF4 and redZ in the dasR mutant. |
| SCO1712 |
Transcripts encoded by pathway-specific activator genes such as actII-ORF4, redD/Z, and cdaR were all significantly increased at both time points from S. coelicolor M145-SCO1712. As expected, an opposite transcription pattern was observed in the SCO1712-overexpressing S. coelicolor M145 strain. |
Terminator
No Data
Overview
|
|