DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

tuf3

Operon: No data

Genes	Gene ID	Synonyms	Direction	Genome position	Function
tuf3	SCO1321	2SCG61.03c, tuf3	-	1396238..1397416	elongation factor TU-3

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
HrdB	-	Promoter	`-50:+10`	1397601..1397660	`TCCATAAAAAACCATTCGACGTGCGACGAAGCGTCGGCGATGATCTGTCTCATGTTCCGG`	van Wezel GP, et al. (1995): S1, RO

Comments:
HrdB	The promoter region of tuf3 overlapped with the coding region of SCO1322.

No Data