DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

vanK

Operons: vanK

Genes	Gene ID	Synonyms	Direction	Genome position	Function
vanK	SCO3593	SC66T3.04, vanK	+	3970005..3971198	conserved hypothetical protein

Operon evidence:	Adjacent TSSs are confirmed.
Reference:	Hong HJ, et al. (2004)

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
Unknown_sigma	-	Promoter	`-50:+10`	3969954..3970013	`TATCGAAAACCGCATACGCGTCGGCAACGTCCCGCCGCCTTGACTGGGGGCATGGCCTAC`	Hong HJ, et al. (2004): S1
VanR	-	Positive	ND	ND	ND	Hong HJ, et al. (2004): DB

Comments:
Unknown_sigma	The transcription start site and the translation start site are the same position.

No Data