DBSCR - Transcription factor

Database of transcriptional regulation in Streptomyces griseus

Home

Transcription factors

Regulated genes

Search

Transcription factor: CebR

Gene ID	SGR_4739 (link to Genome Viewer)
Factor type	LacI family
Pfam	PF00356 (Bacterial regulatory proteins, lacI family )
Consensus seq.	5'-{TGGGAGC}{GCTCCCA}-3'
Comment	CebR is a master regulator of cellulose/cellooligosaccharide catabolism. It is a LacI/GalR family regulator. CebR-disrupted starin formed very few aerial hyphae on lactose-containing medium.

Regulated Gene	Sigma	Regulation	Absolute position	Location	Binding seq.(cis-element)	Experimental evidence
cebE	None	Negative	`5564510..5564540`	`+1:+31`	`AACGGCGCATGGGAGCGCTCCCACTCCAGGG`	Marushima K, et al. (2009): DB,qRT-PCR,EMSA,HM
cebR	None	Negative?	`5569653..5569684`	`-40:-5`	`TCCCCTTCTTGGGAGCGCTCCCAATACACTGT`	Marushima K, et al. (2009): DB,qRT-PCR,EMSA,HM
bglC	None	Negative	`5568107..5568137`	`-28:+7(from translation start site)`	`CACTTCCCCAGGGAGCGCTCCCACATGACAG`	Marushima K, et al. (2009): DB,qRT-PCR,EMSA,HM
SGR_199	None	Negative	`202953..202983`	`-341:-310(from translation start site)`	`ATCAGCGTGTGGGAGCGCTCCCAGATTCTCC`	Marushima K, et al. (2009): DB,qRT-PCR,EMSA,HM
SGR_199	None	Negative	`202758..202789`	`-536:-504(from translation start site)`	`AGTGGGATGCGGGAGCGCTCCCCAATCTGTCA`	Marushima K, et al. (2009): DB,qRT-PCR,EMSA,HM
SGR_217	None	Negative	`227610..227639`	`-118:-89(from translation start site)`	`ACGACGTGCGGGAGCGCTCCCATATGTCAT`	Marushima K, et al. (2009): DB,qRT-PCR,EMSA,HM
SGR_1971	None	Negative	`2327353..2327381`	`-313:-284(from translation start site)`	`TCCCGGGAGGGGAGCGCTCCCAGGTGCCC`	Marushima K, et al. (2009): DB,qRT-PCR,EMSA,HM
SGR_2445	None	Negative	`2883476..2883507`	`-40:-9(from translation start site)`	`CGTCGTCGATTGGGAGCGCTCCCACAGAAGGG`	Marushima K, et al. (2009): DB,qRT-PCR,EMSA,HM
SGR_6928	None	Negative	`8314828..8314858`	`-128:-98(from translation start site)`	`GCGCCAGTTTGGGAGCGCTCCCACACGCACG`	Marushima K, et al. (2009): DB,qRT-PCR,EMSA,HM
SGR_6928	None	Negative	`8314741..8314771`	`-215:-185(from translation start site)`	`GGCCATTGGTGGGAGCGCTCCAACAGCGCTC`	Marushima K, et al. (2009): DB,qRT-PCR,EMSA,HM

DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita