DBSCR - Transcription factor

   Database of transcriptional regulation in Streptomyces

Home
Transcription factors
Regulated genes
Revised TLS
Search
Contacts

Transcription factor: ClgR

GenBank ID no data
Factor type XRE family
Pfam None
Consensus seq. GTTCTC-N5-GCG
Comment ClgR is a positive transcriptional regulator for cytoplasmic proteases. The overexpression of clgR induces a differenciation delay in S. lividans (Billier A, et al. 2004). ClgR does not bind clpP5 promoter region (Billier A, et al. 2004). Bellier A, et al. (2006) suggested that ClpP1/P2 ensure post-transclational control of ClgR regulon members. There are strong similarities between ClgR and PopR.

Regulated Gene Sigma Regulation Location Binding seq.(cis-element) Experimental evidence Organism
clpP1 None Positive -75:-40 CGGAGCGCTACGCCCCCGGCGAACACCCGCAGAACC Bellier A, et al. (2004): GS, FT
S. lividans
clpC1 None Positive None GGTTGTTCGCCCGTAGCGGAGGGAACCGGTG Bellier A, et al. (2004): GS, FT
S. lividans
clpC1 None Positive -170:-140 TCTCGCGTTCGCCATCGGCGTACTGGCGAGT Bellier A, et al. (2004): GS, FT
S. lividans
lon None Positive -60:-30 TTGATCGCTCACAGCGAACAGGGCTTGGGGA Bellier A, et al. (2004): GS, FT
S. lividans
clgR None Positive -70:-40 TGTTTGCAGCCCTGAGTGAACACGACATCGC Bellier A, et al. (2004): GS, FT
S. lividans




DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita