DBSCR - Transcription factor

   Database of transcriptional regulation in Streptomyces

Home
Transcription factors
Regulated genes
Revised TLS
Search
Contacts

Transcription factor: LndYR

GenBank ID no data
Factor type GntR family
Pfam None
Consensus seq. ND
Comment The identification and functional characterization of the Streptomyces globisporus 1912 gene lndYR, which encodes a GntR-like regulator of the YtrA subfamily.

Regulated Gene Sigma Regulation Location Binding seq.(cis-element) Experimental evidence Organism
lndW None Negative -143:-83(from translation start site) TGACAGTCATTCCCTCACGACTCCATGATTCCATTAATTGATTCATGGAATCACGATCA Ostash B, et al. (2011): DB, DP, GS, RT-PCR
S. globisporus
lndI None Negative ND ND Ostash B, et al. (2011): DB, GS, RT-PCR
S. globisporus




DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita