DBSCR - Transcription factor

   Database of transcriptional regulation in Streptomyces

Home
Transcription factors
Regulated genes
Revised TLS
Search
Contacts

Transcription factor: PopR

GenBank ID no data
Factor type ND
Pfam None
Consensus seq. TCTGCC-N3-GGCAGA
Comment PopR (clpP3 operon regulator) gene locates downstream of clpP4 gene. Degradation of PopR is dependent on ClpP1 and clpP2. The two carboxy-terminus alanine residue of PopR play an essential part in the degradation signal (Viala J, et al. 2002).

Regulated Gene Sigma Regulation Location Binding seq.(cis-element) Experimental evidence Organism
clpP3 None Positive -75:-35 ATCGCTCTGCCGGTGGCGAATCTGCCGCGGGCAGAGAAGTC Viala J, et al. (2000): GS, OV, FT
S. lividans




DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita