Operon: No data
| SCO5447 |
SCO5447 |
SC3D11.04c |
- |
5927688..5929742 |
putative neutral zinc metalloprotease |
Promoters
| PhoP |
- |
Positive |
-264:-214(from translation start site) |
5929956..5930006 |
AGCAACGATTCCGTTTATCGAACGTGAACGCCCGGTCAACGAACCATTTCC |
Sola-Landa A, et al. (2008): HM, DB, GS, FT
|
| Comments:
|
| PhoP |
Twenty promoters were amplified by PCR and analysed by EMSA. These promoters showing positive binding. SCO1196 (a putative secreted protein), SCO1394 (a possible glycosyl hydrolase), SCO1906 and SCO3790 (putative phosphatases different from phoA, phoC, phoD), SCO2262 (a possible oxidoreductase), SCO5447 (a putative neutral zinc metalloprotease), SCO6169 (a possible regulatory protein), encoding a heat-inducible transcriptional repressor, hrdA (SCO2465). |
Terminator
No Data
Overview

|
|