Operon: No data
| SCO1196 |
SCO1196 |
SCG11A.27c |
- |
1267630..1268493 |
putative secreted protein |
Promoters
| PhoP |
- |
Positive |
-132:-83(from translation start site) |
1268576..1268625 |
TCCGGTGAGGTGAACGACCGAAGTGAACGACCGGCGGCGGTCCGGCCAAC |
Sola-Landa A, et al. (2008): HM, DB, GS, FT
|
| Comments:
|
| PhoP |
Twenty promoters were amplified by PCR and analysed by EMSA. These promoters showing positive binding. SCO1196 (a putative secreted protein), SCO1394 (a possible glycosyl hydrolase), SCO1906 and SCO3790 (putative phosphatases different from phoA, phoC, phoD), SCO2262 (a possible oxidoreductase), SCO5447 (a putative neutral zinc metalloprotease), SCO6169 (a possible regulatory protein), encoding a heat-inducible transcriptional repressor, hrdA (SCO2465). In the SCO1196 protected region, a well-conserved DRu (Direct Repeat units) is 2-nt apart from three consecutive DRus. |
Terminator
No Data
Overview

|
|