DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

chiD

Operon: No data

Genes	Gene ID	Synonyms	Direction	Genome position	Function
chiD	SCO1429		+	1524785..1526038	chitinase (putative secreted protein)

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
Unknown_sigma	-	Promoter	`-50:+10`	1524666..1524725	`GAATGGTCCGAACCATTGACCACACTGGTCTAGTCCTCCTACGGTGACGGACCGAGCGCA`	Saito A, et al. (2000): PE

Comments:
Unknown_sigma	The trancription of chi genes is repressed by glucose and the repression is mediated by the glucose kinage gene glkA. Chi genes has TGGTC(C/T)(A/G)GACC(A/T) consensus sequences both side of -35 motif.

No Data