DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

glpQ2

Operon: No data

Genes	Gene ID	Synonyms	Direction	Genome position	Function
glpQ2	SCO1968	SC3C9.03, glpQ2	+	2108409..2109278	putative secreted hydrolase

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
PhoP	-	Positive	`-74:-12`	2108304..2108365	`AGTTGAGCAACTCCATTCAGCCTGTGGCCACTCCGCACCCCCCTTTCGTTGACTCTCTGATG`	Rodr_guez-Garc_a A, et al. (2007): 2D-gel, DB, GS Santos-Beneit F, et al. (2009): DB, RG, FT, PE

Comments:
PhoP	An interaction of phosphate control mediated by PhoP and carbon source regulation of the glpQ1 and glpQ2 genes involving complex operator structures.

No Data