Operon: No data
hpdR |
SCO2935 |
SCE19A.35c, hpdD, hpdR |
- |
3186380..3187042 |
putative transcriptional regulator |
Promoters
HpdR |
- |
Negative |
-125:+34 |
3187218..3187377 |
CAAGGTCCAGGAGTGGGCGACGCGGATGAAGTGACACGCGGGGTACCGGTGCCGAGGGCGTGCGCGGTACGTACTGGGACAAACACAGGCGGTTGATAACGGTTGGCGCCCGGATTCTGGACGGAGCCTTCCGCTGAGCGAACCGGGTCCTTTACTGTCC |
Yang H, et al. (2010): DB, OV, GS, S1
|
Comments:
|
HpdR |
S1 mapping assay showed that the transcription of the hpdR promoter in hpdRDMJ-P was at nearly the same level as that of J1501 at24 h, but it remained at the same level from 24 h to 120 h,whereas the transcription of hpdR in J1501 decreased after48 h (Fig. 2). A 159 bp probe (2125 to +34 relative to the tsp), containing the 235, 210 and tsp regions of the hpdR
promoter, was bound by HpdR and exhibited a similar profile (data not shown). |
Terminator
No Data
Overview

|
|