DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

malE

Operon: No data

Genes	Gene ID	Synonyms	Direction	Genome position	Function
malE	SCO2231	SC10B7.26c, malE	-	2398988..2400259	putative maltose-binding protein

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
Unknown_sigma	-	Promoter	`-50:+10`	2400345..2400404	`TTTTGCAGCAAGACCTTTCGCCAGGCTTTCAACGCTGTTACGTTCACGTCGCCCGACGGC`	van Wezel GP, et al. (1997): S1 van Wezel GP, et al. (1997): -
MalR	-	Negative	ND	ND	ND	van Wezel GP, et al. (1997): OV, DB

Comments:
MalR	It is unclear that the regulation is direct or not.

No Data