DBSCR - Regulated genes

   Database of transcriptional regulation in Streptomyces coelicolor
Home
 Transcription factors
 Regulated genes
 Revised TLS
 Search
 Contacts

Regulated gene: parA

Operons: parAB

Genes Gene ID Synonyms Direction Genome position Function
parA SCO3886 StH24.08, parA + 4277251..4278078 putative partitioning or sporulation protein
parB SCO3887 StH24.09, parB + 4278195..4279181 putative partitioning or sporulation protein

Reference: Kim HJ, et al. (2000)

Promoters

Binding
factor		 Promoter
name		 Regulation Location Absolute position Binding seq.(cis-element) Experimental evidence
Unknown_sigma parA-p2 Promoter -50:+10 4276788..4276847 ATGCCGGAGTGTCGCGGCAGTTCGGCATCAGCGGCTGTGCATCGTGTTTCACGTGAAACG Kim HJ, et al. (2000): S1
Jakimowicz D, et al. (2006): DP
Unknown_sigma parA-p1 Promoter -50:+10 4276973..4277032 ACCAGGCCTCACTGGTTCATGACCCCAGAGGCATGGGAGGCTCTGTTCATTGCGAGCCTG Kim HJ, et al. (2000): S1
Jakimowicz D, et al. (2006): DP
WhiA parA-p2 Positive ND ND ND Jakimowicz D, et al. (2006): DB (S1 protection)
WhiB parA-p2 Positive ND ND ND Jakimowicz D, et al. (2006): DB (S1 protection)
WhiH parA-p2 Positive ND ND ND Jakimowicz D, et al. (2006): DB (S1 protection)
WhiI parA-p2 Positive ND ND ND Jakimowicz D, et al. (2006): DB (S1 protection)

Comments:
Unknown_sigma parA-p2 required for sporulation-specific induction
Unknown_sigma parA-p1 is a constitutive promoter in vegetative hyphae. This promoter was not affected in the nonsporulating strains.
WhiA Jakimowicz D, et al. (2006) showed that transcript of parA-p2 was abolished in whiA deletion strain. The constitutive parAB-p1 promoter was not affected in the nonsporulating strains.
WhiB Jakimowicz D, et al. (2006) showed that transcript of parA-p2 was abolished in whiB deletion strain. The constitutive parAB-p1 promoter was not affected in the nonsporulating strains.
WhiH Jakimowicz D, et al. (2006) showed that transcription of parA-p2 was partialy dependent on WhiH. The constitutive parAB-p1 promoter was not affected in the nonsporulating strains.
WhiI Jakimowicz D, et al. (2006) showed that transcription of parA-p2 was partialy dependent on WhiI. The constitutive parAB-p1 promoter was not affected in the nonsporulating strains.

Terminator

No Data

Overview

DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita