DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

wblE

Operon: No data

Genes	Gene ID	Synonyms	Direction	Genome position	Function
wblE	SCO5240	2SC7G11.02c, wblE	-	5701855..5702112	hypothetical protein

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
BldN?	-	Promoter	`-50:+10`	5702277..5702336	`AAACTTTCCGGAAGGGGTTGTATCCGTCGCCGAGGTTTGCGAGTCTCTTCTTGGCGATCG`	Homerova D, et al. (2003): S1

Comments:
BldN?	The promoter of wblE is recognized by ECF sigma factor.

No Data