DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

griT

Operons: griT

Genes	Gene ID	Synonyms	Direction	Genome position	Function
griT	SGR_4238		-	4957169..4958371	putative LuxR-family transcriptional regulator

Operon evidence:	Genome analysis; both upstream and downstream genes are on the opposite strand
Reference:

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
Unknown_sigma	-	Promoter	`-50:+10`	4958362..4958421	`CCCTCAGACAGGGGGTTGGAGCGGGACGACGGGACTGTCACAGTCGGGGGATGACCGGTT`	Higashi T, et al. (2007): S1

No Data