DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

stsC

Operon: No data

Genes	Gene ID	Synonyms	Direction	Genome position	Function
stsC	SGR_5921		-	6928245..6929519	putative L-glutamine:scyllo-inosose aminotransferase

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
StrR	-	Positive	ND	6929623..6929674	`GCGTACTCATCCGTTCGACTGTGTGTGTTCCTCGGTCGAACACCTTCGGCAT`	Tomono A, et al. (2005): DB Retzlaff L, et al. (1995): GS,FT

Comments:
StrR	This gene does not express in the strR-disrupted strain. (Direct or indirect regulation is not clear.)

No Data