DBSCR - Transcription factor

Database of transcriptional regulation in Streptomyces griseus

Home

Gene ID	SGR_5931 (link to Genome Viewer)
Factor type	ND
Pfam	None
Consensus seq.	GTTCGActG-N11-CagTcGAAc
Comment	Pathway specific activator for Streptomycin (Sm) synthesis.
Orthologous link	Other Streptomyces

Regulated Gene	Sigma	Regulation	Absolute position	Location	Binding seq.(cis-element)	Experimental evidence
aphD	None	Positive	`6940175..6940225`	`-390:-340`	`CCCTCAGGTCCTGTTCGACTGCCGGGGTTCCGCAGTCGAACGTGAGGATCG`	Retzlaff L, et al. (1995): GS,HM
strR	None	Positive	ND	ND	ND	Tomono A, et al. (2005): DB
strB1	None	Positive	`6941970..6942035`	`-125:-60`	`CGCCGCACCTCCGATGCGTTCGACTGCCGATCACACGCAGTCGAACGCATCCGGCGTCCGCCGGCG`	Tomono A, et al. (2005): DB Retzlaff L, et al. (1995): FT,GS
strD	None	Positive	ND	ND	ND	Tomono A, et al. (2005): DB
strN	None	Positive	ND	ND	ND	Tomono A, et al. (2005): DB
strO	None	Positive	ND	ND	ND	Tomono A, et al. (2005): DB
stsB	None	Positive	ND	ND	ND	Tomono A, et al. (2005): DB
stsC	None	Positive	`6929623..6929674`	None	`GCGTACTCATCCGTTCGACTGTGTGTGTTCCTCGGTCGAACACCTTCGGCAT`	Tomono A, et al. (2005): DB Retzlaff L, et al. (1995): GS,FT
strV	None	Positive	ND	ND	ND	Tomono A, et al. (2005): DB
strU	None	Positive	ND	ND	ND	Tomono A, et al. (2005): DB