Operon: No data
Promoters
AlpZ |
- |
Negative |
-231:-206 (from translational start site) |
GTGAGAACGGGGTGTTCTGGTGTTTG |
Bunet R, et al. (2008): DB, GS, SDM, RT-PCR
|
S. ambofaciens |
Comments:
|
AlpZ |
Deletion of the two copies of alpZ resulted in the precocious production of both alpomycin and the orange pigment, suggesting a repressor role for AlpZ. Furthermore, recombinant AlpZ was shown to bind to specific DNA sequences within the promoter regions of alpZ, alpV, and alpXW, suggesting direct transcriptional control of these genes by AlpZ. AlpZ binds to a specific DNA sequence that resembles the ARE motifs recognized by typical gamma-butyrolactone receptors. |
Terminator
No Data
|
|