Transcription factor: AlpZ
| GenBank ID |
no data |
| Factor type |
ND |
| Pfam |
None |
| Consensus seq. |
ND |
| Comment |
Recombinant AlpZ was shown to bind to specific DNA sequences within the promoter regions of alpZ, alpV, and alpXW, suggesting direct transcriptional control of these genes by AlpZ. |
| alpZ |
None |
Negative |
-86:-61 (from translational start site) |
GAAAATACGGACTCCCTGGTTTTGTT |
Bunet R, et al. (2008): DB, GS, SDM, RT-PCR
|
S. ambofaciens |
| alpV |
None |
Negative |
-116:-91 (from translational start site) |
TGACAAACCGACTGTGCTGTTTTTTT |
Bunet R, et al. (2008): DB, GS, SDM, RT-PCR
|
S. ambofaciens |
| alpX |
None |
Negative |
-66:-41 (from translational start site) |
CTAAAAACCGCACGGACGGTTCGTTA |
Bunet R, et al. (2008): DB, GS, SDM, RT-PCR
|
S. ambofaciens |
| alpU |
None |
Negative |
-231:-206 (from translational start site) |
GTGAGAACGGGGTGTTCTGGTGTTTG |
Bunet R, et al. (2008): DB, GS, SDM, RT-PCR
|
S. ambofaciens |
|