Operon: No data
Promoters
| HrdB |
- |
Promoter |
-50:+10 |
ATCAAAGTCAGCGACCTTGACACTACCCCGCCCACCAGGGCAAATTCATAACACTGACCA |
Zhuo Y, et al. (2010): HM, RO, SDM
|
S. avermilitis |
| Comments:
|
| HrdB |
Based on the consensus promoter-binding sequence, aveRp was the candidate sigma-hrdB-specific promoter. Since we detected a sigma-hrdB-dose dependent level of in vitro transcription from aveRp with reconstituted Esigma-hrdB holoenzyme, we surmise that sigma-hrdB perhaps recognizes aveRp in vivo; the potential -10 and -35 sequence of aveRp was similar to the proposed consensus sequence for the major holoenzyme. |
Terminator
No Data
|
|