Transcription factor: HrdB
| GenBank ID |
no data |
| Factor type |
ND |
| Pfam |
None |
| Consensus seq. |
ND |
| Comment |
A mutant library of hrdB gene was constructed by error-prone PCR and selected by high-throughput screening. As a result of evolved hrdB expressed in the modified avermectin high-producing strain, 6.38 g?L of avermectin B1a was produced with over 50% yield improvement, in which the transcription level of aveR was significantly increased. The relevant residues were identified to center in the conserved regions. |
| aveR |
None |
Promoter |
-50:+10 |
ATCAAAGTCAGCGACCTTGACACTACCCCGCCCACCAGGGCAAATTCATAACACTGACCA |
Zhuo Y, et al. (2010): HM, RO, SDM
|
S. avermilitis |
| rrnD1 |
None |
Promoter |
-50:+10 |
CGCCCCGCAGGAGCCGTTGACACGGCTCAGGCGAGGAGGTAGATTTGAACAGTTGCCTAG |
Zhuo Y, et al. (2010): HM, RO, SDM
|
S. avermilitis |
|