DBSCR - Transcription factor

   Database of transcriptional regulation in Streptomyces coelicolor
Home
 Transcription factors
 Regulated genes
 Revised TLS
 Search
 Contacts

Transcription factor: CatR

Gene ID SCO5206 (link to ScoCyc)
Factor type ND
Pfam PF01475 (Ferric uptake regulator family ) PF00486 (Transcriptional regulatory protein, C terminal ) PF03704 (Bacterial transcriptional activator domain )
Consensus seq. TCc-RARY-R---Y-RYTY-gGA
Comment None

Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
catR None Negative 5667381..5667430 -70:-20 (p1) CTAATTCGAGCAGGACTCCAAAATCACACCCATTCGGGACCTGGTCCCCC Hahn JS, et al. (2000): DB, GS, DP
catA None Negative 393401..393440 -70:-30 TCAATTCAAGAGCGAATATTGCTCTAGATGCCGCCTTGCC Hahn JS, et al. (2000): DB, GS, DP



DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita