Transcription factor: FasR
| Gene ID |
SCO2386 (link to ScoCyc) |
| Factor type |
ND |
| Pfam |
None |
| Consensus seq. |
ND |
| Comment |
A novel transcription factor, FasR (SCO2386), controls
expression of fabDHPF operon and lies immediately
upstream of fabD, in a cluster of genes that is highly
conserved within actinomycetes. Expression of fab
genes was downregulated in the fasR mutant, indicating
a role for this transcription factor as an activator. FasR binds specifically to a DNA sequence containing fabDHPF promoter region, both in vivo and in vitro. |
| fabD |
None |
Positive |
2559253..2559273 |
-87:-67(from translation start site) |
TTTTGTGCAGGGTCCACAAAA |
Xu D, et al. (2010): OV, HM, GS, qRT-PCR
|
|