Transcription factor: NdgR
| Gene ID |
SCO5552 (link to ScoCyc) |
| Factor type |
IclR-family |
| Pfam |
None |
| Consensus seq. |
ND |
| Comment |
NdgR shown by gel mobility shift assay, binds to promoter of glnR, suggesting indirect regulation of glutamine metabolism by NdgR. NdgR protein binds to intergenic region of ndgR-leuC, and scbR-scbA involved in gamma-butyrolactone. |
| scbR |
None |
Positive |
6891176..6891199 |
-24:-13(from translation start site) |
GGAGACATGAACAAGGAGGCAGGC |
Yang YH, et al. (2009): DP, GS, HM
|
| leuC |
None |
Positive |
6051848..6051866 |
-162:-152(from translation start site) |
CAAGTTCAATTTTCCATGG |
Yang YH, et al. (2009): DP, GS, HM, RT-PCR
|
|