Transcription factor: OhrR
| Gene ID |
SCO2987 (link to ScoCyc) |
| Factor type |
MarR/SlyA family |
| Pfam |
PF01047 (MarR family
)
|
| Consensus seq. |
ND |
| Comment |
Dual regulator, OhrR, response to organis hydroperoxides. |
| Link to |
Weight matrix & Motif alignment
|
| ohrA |
None |
Negative |
3257038..3257090 |
-65:-13 |
TGTCCGCGATTTAGTTGTGTGCAATTTAGTTGCGCGCGATCAAATGGCGTGCT |
Oh SY, et al (2007): GS, FT
|
| ohrR |
None |
Negative |
3257038..3257090 |
-78:-26 |
AGCACGCCATTTGATCGCGCGCAACTAAATTGCACACAACTAAATCGCGGACA |
Oh SY, et al (2007): GS, FT
|
| ohrR |
None |
Positive |
3257050..3257078 |
-66:-38 |
GATCGCGCGCAACTAAATTGCACACAACT |
Oh SY, et al (2007): GS, FT
|
|