Transcription factor: RamR
Gene ID |
SCO6685 (link to ScoCyc) |
Factor type |
ND |
Pfam |
PF00196 (Bacterial regulatory proteins, luxR family
)
PF00072 (Response regulator receiver domain
)
|
Consensus seq. |
ND |
Comment |
Ortholog gene of AmfR in {i}S. griseus{/i}. |
Orthologous link |
S. griseus
|
ramC |
None |
Positive |
7419570..7419700 |
-145:-15 |
CCGCCCCGGCAACAGCCCTTCCGCCACGCGGAATTCTCCCGCTCCGGGAGTCCCGCCGCCGCGAAGTTACTTGTGCGTTCCGCACCTCGGAGTGGTGACAGCCGCAACTGTCCGAGGCGGTACGCCGCGTG |
O'Connor TJ, et al. (2002): OV, GS, DB
Chater KF, et al. (2003): Review
Nguyen KT, et al. (2002): GS,RG
|
ragA |
None |
Positive |
4469766..4469828 |
-80:-18 |
GGTGCCCGGCGGCTCTGACATTTGTCATGTCCGGTGATGACGGCTCGCACTGTCGTCCCGCCC |
San Paolo S, et al. (2006): OV, GS, FT, DB
|
|