DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

SCO7676

Operon: No data

Genes	Gene ID	Synonyms	Direction	Genome position	Function
SCO7676	SCO7676	SC4C2.11	+	8499061..8499282	putative ferredoxin

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
Zur	-	Negative	ND	8498987..8499008	`GATGAATGTCGTTTTCTATTAA`	Kallifidas D, et al. (2010): AR, DB, GS, qPCR

Comments:
Zur	The Zinc-Responsive Regulator Zur Controls Expression of the Coelibactin Gene Cluster in Streptomyces coelicolor.

No Data