Operons:
cwgABCDEFGHIJKL
| cwgA |
SCO6179 |
SC6C5.15, cwgA |
+ |
6783983..6784975 |
putative nucleotide-sugar dehydratase |
| cwgB |
SCO6180 |
SC2G5.01, SC6C5.16, cwgB |
+ |
6785096..6786736 |
putative transferase |
| cwgC |
SCO6181 |
SC2G5.02, cwgC |
+ |
6786733..6787767 |
putative transferase |
| cwgD |
SCO6182 |
SC2G5.03, cwgD |
+ |
6787764..6788621 |
putative dehydratase |
| cwgE |
SCO6183 |
SC2G5.04, cwgE |
+ |
6788618..6789625 |
putative transferase |
| cwgF |
SCO6184 |
SC2G5.05, cwgF |
+ |
6789622..6790572 |
putative transferase |
| cwgG |
SCO6185 |
SC2G5.06, cwgG |
+ |
6790569..6791789 |
putative transferase |
| cwgH |
SCO6186 |
SC2G5.07, cwgH |
+ |
6791786..6792481 |
putative phosphoheptose isomerase |
| cwgI |
SCO6187 |
SC2G5.08, cwgI |
+ |
6792478..6793869 |
putative bifunctional synthase/transferase |
| cwgJ |
SCO6188 |
SC2G5.09, cwgJ |
+ |
6793866..6795566 |
putative transferase |
| cwgK |
SCO6189 |
SC2G5.10, cwgK |
+ |
6795563..6796516 |
putative transferase |
| cwgL |
SCO6190 |
SC2G5.11, cwgL |
+ |
6796513..6797409 |
putative transferase |
| Operon evidence: |
cwgA-cwgB are cotranscribed, the others are form genome analysis
|
| Reference: |
Hong HJ, et al. (2002)
|
Promoters
| SigE |
- |
Promoter |
-50:+10 |
6783792..6783851 |
AAGGTCGCGAGCACACGCAACCTGGTCCCCGTTTTCGTCGTCTTCCTGGTCAGCGAAGGC |
Hong HJ, et al. (2002): S1, DB
|
Terminator
No Data
Overview

|
|