DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

sodF

Operon: No data

Genes	Gene ID	Synonyms	Direction	Genome position	Function
sodF	SCO2633	SC8E4A.03, sodF	+	2860089..2860730	superoxide dismutase [Fe-Zn] (EC 1.15.1.1)

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
Nur	-	Negative	`-30:+30`	2860021..2860081	`TTCCGAGCCTCTTGCTGCTAGCGTGCAGTTGCAAGGCTTTTGCAATAAGAGGCCGGAGGGG`	Chung HJ, et al. (1999): GS Ahn BE, et al. (2006): GS, S1, DB An YJ, et al. (2009): FT

Comments:
Nur	Nur negatively regultes sodF and sodF2 in the presence of nickel (NiSO4).

No Data