DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

sodF2

Operon: No data

Genes	Gene ID	Synonyms	Direction	Genome position	Function
sodF2	SCO0999	2SCG2.12c, sodF2	-	1054754..1055401	superoxide dismutase

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
Nur	-	Negative	`-30:+30`	1055407..1055467	`AGATGCCGTTCTTGCTGTTAGCGTGCAGCTGCATACAACACGCAATAACGTCGGAGGGCGT`	Ahn BE, et al. (2006): S1, DB An YJ, et al. (2009): FT

Comments:
Nur	Nur negatively regultes sodF and sodF2 in the presence of nickel (NiSO4).

No Data