DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

ssgB

Operon: No data

Genes	Gene ID	Synonyms	Direction	Genome position	Function
ssgB	SCO1541	SCL2.31, ssgB	+	1650311..1650790	putative regulator

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
SigH	-	Promoter	`-50:+10`	1650275..1650334	`GCAAAACACTCAGAGGGGTTTACAACGGCACCGTAGGTGGCATGTCGATTTCGCCGACGT`	Kormanec J, et al. (2002): S1, DB

Comments:
SigH	ssgB is not depending on SigF (homologous gene of SigH)

No Data