DBSCR - Regulated genes

   Database of transcriptional regulation in Streptomyces coelicolor
Home
 Transcription factors
 Regulated genes
 Revised TLS
 Search
 Contacts

Regulated gene: ushX

Operons: ushYX-sigH

Genes Gene ID Synonyms Direction Genome position Function
ushY SCO5245 2SC7G11.07c, ushY - 5705753..5706013 conserved hypothetical protein
ushX SCO5244 2SC7G11.06c, prs, prsH, ushX - 5705089..5705502 anti-sigma factor
sigH SCO5243 2SC7G11.05c, sig1, sig37, sig52, sigH - 5704007..5705092 RNA polymerase sigma factor

Operon evidence: transcriptional analylsis
Reference: Kormanec J, et al. (2000)

Promoters

Binding
factor		 Promoter
name		 Regulation Location Absolute position Binding seq.(cis-element) Experimental evidence
SigH sigH-p2 Promoter -50:+10 5705695..5705754 GACCTGTGCCCGGGACGGTTCGACCGTCTGACGTCTGGGTACGTCAACCCGGCGCGCGCT Kormanec J, et al. (2000): S1
Sevcikova B, et al. (2002): DB
Sevcikova B, et al. (2001): S1
Unknown_sigma sigH-p3 Promoter -50:+10 5705625..5705684 GGGCCCGCCGACCCCCTAGCCACTGTGCGTGTTCGCGTGTTTACTATGAGTGACAGCACG Kormanec J, et al. (2000): S1
Sevcikova B, et al. (2001): S1
Kelemen GH, et al. (2001): S1
Unknown_sigma sigH-p4 Promoter -50:+10 5705565..5705624 GGGTTGGGGTCTCGGGGACAGGAAACTTCGGAGCGCGATAACGTCACCGCTGAACCACGT Kormanec J, et al. (2000): S1
Sevcikova B, et al. (2001): S1
Kelemen GH, et al. (2001): S1

Comments:
SigH SigH-P2 promoter is strongly induced after salt stress, weakly expressed after heat shock and ethanol stress (Kormanec J, et al. 2000).
Unknown_sigma SigH-P3 promoter is strongly induced after heat shock, and weakly induced after salt and ethanol stress (Kormanec J, et al. 2000).
SigH-P3 promoter sequence has potential CIRCE motif (HrcA repressor binding motif: GCACTC-N9-GAGTGC) at the end of -35 motif to -10 motif.
Kelemen GH, et al. (2001) described this promoter as sigH-P2.
Unknown_sigma SigH-P4 promoter is induced after salt, ethanol, and heat shock stress (Kormanec J, et al. 2000).
Kelemen GH, et al. (2001) described this promoter as sigH-P1.

Terminator

No Data

Overview

DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita