| Regulated gene:
| whiE-ORFI
|
Operon: No data
| whiE-ORFI |
SCO5320 |
SC6G9.13, whiE-ORFI |
- |
5790104..5791297 |
whiE protein I |
Promoters
| AmfC |
whiE-p1 |
Negative |
ND |
ND |
ND |
Yonekawa Y, et al. (1999): OV, DB
|
| Unknown_sigma |
whiE-p1 |
Promoter |
-50:+10 |
5791373..5791432 |
TAACCCTCCTGGTTCGCGGTCCCCGCGGGCACGGCCCACGATCGTGCTTACGCGACCGTC |
Kelemen GH, et al. (1998): S1, PE
|
| WhiA |
whiE-p1 |
Positive |
ND |
ND |
ND |
Kelemen GH, et al. (1998): DB (S1 protection)
|
| WhiB |
whiE-p1 |
Positive |
ND |
ND |
ND |
Kelemen GH, et al. (1998): DB (S1 protection)
|
| WhiG |
whiE-p1 |
Positive |
ND |
ND |
ND |
Kelemen GH, et al. (1998): DB (S1 protection)
|
| WhiI |
whiE-p1 |
Positive |
ND |
ND |
ND |
Kelemen GH, et al. (1998): DB (S1 protection)
|
| WhiH |
whiE-p1 |
Positive |
ND |
ND |
ND |
Kelemen GH, et al. (1998): DB (S1 protection)
|
| WhiJ |
whiE-p1 |
Positive |
ND |
ND |
ND |
Kelemen GH, et al. (1998): DB (S1 protection)
|
| Comments:
|
| Unknown_sigma |
WhiE-p1 is not transcribed by either of known sporulation-specific sigma factors, WhiG and SigF. |
| WhiH |
WhiE-p1 is strongly, but not absolutely dependent on WhiH. |
| WhiJ |
WhiE-p1 is strongly, but not absolutely dependent on WhiJ. |
Terminator
No Data
Overview

|
|