DBSCR - Regulated genes

   Database of transcriptional regulation in Streptomyces coelicolor
Home
 Transcription factors
 Regulated genes
 Revised TLS
 Search
 Contacts

Regulated gene: whiE-ORFI

Operon: No data
Genes Gene ID Synonyms Direction Genome position Function
whiE-ORFI SCO5320 SC6G9.13, whiE-ORFI - 5790104..5791297 whiE protein I

Promoters

Binding
factor		 Promoter
name		 Regulation Location Absolute position Binding seq.(cis-element) Experimental evidence
AmfC whiE-p1 Negative ND ND ND Yonekawa Y, et al. (1999): OV, DB
Unknown_sigma whiE-p1 Promoter -50:+10 5791373..5791432 TAACCCTCCTGGTTCGCGGTCCCCGCGGGCACGGCCCACGATCGTGCTTACGCGACCGTC Kelemen GH, et al. (1998): S1, PE
WhiA whiE-p1 Positive ND ND ND Kelemen GH, et al. (1998): DB (S1 protection)
WhiB whiE-p1 Positive ND ND ND Kelemen GH, et al. (1998): DB (S1 protection)
WhiG whiE-p1 Positive ND ND ND Kelemen GH, et al. (1998): DB (S1 protection)
WhiI whiE-p1 Positive ND ND ND Kelemen GH, et al. (1998): DB (S1 protection)
WhiH whiE-p1 Positive ND ND ND Kelemen GH, et al. (1998): DB (S1 protection)
WhiJ whiE-p1 Positive ND ND ND Kelemen GH, et al. (1998): DB (S1 protection)

Comments:
Unknown_sigma WhiE-p1 is not transcribed by either of known sporulation-specific sigma factors, WhiG and SigF.
WhiH WhiE-p1 is strongly, but not absolutely dependent on WhiH.
WhiJ WhiE-p1 is strongly, but not absolutely dependent on WhiJ.

Terminator

No Data

Overview

DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita