DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

SGR_5809

Operons: SGR_5809

Genes	Gene ID	Synonyms	Direction	Genome position	Function
SGR_5809	SGR_5809		+	6804558..6805895	putative aminopeptidase

Operon evidence:	S1 promoter analysis for SGR_5809, downstream gene is on the opposite strand
Reference:	Akanuma G, et al. (2009)

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
AdpA	-	Positive	`-63:-34`	6804377..6804406	`AGAACGGCTATGTCCGGTTTCCGCTCTTGA`	Akanuma G, et al. (2009): DB, GS, HM
Unknown_sigma	-	Promoter	`-50:+10`	6804390..6804449	`CCGGTTTCCGCTCTTGACGGAGCACTGTCATTTCCTTGAGCATCGGTCACGCATTGCGCA`	Akanuma G, et al. (2009): S1

No Data