DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

sprT

Operons: sprT

Genes	Gene ID	Synonyms	Direction	Genome position	Function
sprT	SGR_1241		+	1465719..1466498	trypsin precursor

Operon evidence:	S1 promoter analysis for sprT, downstream gene is on the opposite strand
Reference:	Kato JY, et al. (2005)

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
AdpA	-	Positive	`-63:-33`	1465579..1465608	`CGTACGAGCTTGGCCGAAATGTGCGCCTTG`	Kato JY, et al. (2005): DB, GS, FT
Unknown_sigma	-	Promoter	`-50:+10`	1465592..1465651	`CCGAAATGTGCGCCTTGTGGCAGCGGCCACCCGTTCCCGACAATCGCAGCATCTTGACGG`	Kato JY, et al. (2005): S1

No Data