DBSCR - Regulated genes

Database of transcriptional regulation in Streptomyces coelicolor

Home

Regulated gene:

sprU

Operons: sprU

Genes	Gene ID	Synonyms	Direction	Genome position	Function
sprU	SGR_5506		+	6467418..6468185	trypsin precursor

Operon evidence:	S1 promoter analysis for sprU, downstream gene is on the opposite strand
Reference:	Kato JY, et al. (2005)

Binding factor	Promoter name	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
AdpA	-	Positive	`-62:-33`	6467108..6467137	`CCGATGATCTTGGCCGAAAAGTGCACCTTG`	Kato JY, et al. (2005): DB, GS, FT
Unknown_sigma	-	Promoter	`-50:+10`	6467120..6467184	`GCCGAAAAGTGCACCTTGTGGCAGCGGTCACGCGGCACCGATAATCGGAGTGTTCTTGTCGAGTA`	Kato JY, et al. (2005): S1

No Data