DBSCR - Transcription factor

   Database of transcriptional regulation in Streptomyces griseus
Home
 Transcription factors
 Regulated genes
 Revised TLS
 Search
 Contacts


Transcription factor: AtrA-g

Gene ID SGR_3905 (link to Genome Viewer)
Factor type TetR family
Pfam None
Consensus seq. 5'-{GGAggG}XXX{CgtTCC}-3'
Comment TetR-family transcriptional regulator. AtrA, a transcriptional activator for actII-ORF4, encoding the pathway-specific transcriptional activator of the actinorhodin biosynthetic gene cluster in Streptomyces coelicolor A3(2).
Orthologous link S. coelicolor

Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
strR None Positive 6939497..6939522 -142:-117 TGGCTGGAGGGGGCCGTTCCGGTCCT Hirano S, et al. (2008): GS, DB, FT



DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita