DBSCR - Transcription factor

   Database of transcriptional regulation in Streptomyces coelicolor

Home
Transcription factors
Regulated genes
Revised TLS
Search
Contacts

Transcription factor: AtrA

Gene ID SCO5260 (link to ScoCyc)
Factor type ND
Pfam None
Consensus seq. ND
Comment None
Orthologous link S. griseus

Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
actII-ORF4 None Positive 5527887..5527915 None CGTATCAGGAATGCCAGATTCTATTGATT Uguru GC, et al. (2005): GS, FT, DP, DB
actII-ORF4 None Positive 5528131..5528166 None CCGATGCGGGATGTGTAATTCCGCTTAAATCCTCGA Uguru GC, et al. (2005): GS, FT, DP, DB
nagE2 None Positive 3159141..3159155 -88:-73(from translation start site) GGAATCACGGGTTCC Nothaft H, et al. (2010): HM, GS, DB(by sqRT-PCR)




DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita