Operons:
strR-ahpD
| strR |
SGR_5931 |
|
+ |
6939694..6940746 |
streptomycin biosynthesis operon regulator |
| ahpD |
SGR_5932 |
aphD, ahpD, aphD, strA |
+ |
6940981..6941904 |
streptomycin 6-phosphotransferase |
| Operon evidence: |
Northern blot analysis (2.8 kb and 2.4 kb for strR-ahpD operon, 1.4 kb for strR monocistron)
|
| Reference: |
Distler J, et al. (1987)
|
| Comments: |
Promoter aphD-P1 seemed to be the preferred to express in the logarithmic growth phase. Readthrough terminator may exist behind strR.
|
Promoters
| AdpA |
strR-siteA |
Positive |
-72:-19 |
6939566..6939620 |
CGAGGTCGCTTTTCGGTCATGCGGACAGCTTTACTTGGCCGTTGCCCGGATGTCC |
Ohnishi Y, et al. (1999): S1, DB
Yamazaki H, et al. (2000): GS
Tomono A, et al. (2005): GS,DB,FT
|
| AdpA |
strR-siteB |
Positive |
-291:-250 |
6939348..6939389 |
TTATCGAAGAGAATCAGCCGCCGTGGCGCGATCCTGTGCATC |
Ohnishi Y, et al. (1999): S1, DB
Yamazaki H, et al. (2000): GS
Tomono A, et al. (2005): GS,DB,FT
|
| Unknown_sigma |
- |
Promoter |
-50:+10 |
6939589..6939648 |
GACAGCTTTACTTGGCCGTTGCCCGGATGTCCGGGTGCTACTATTCGCGAAGTGCGAAAG |
Tomono A, et al. (2005): S1
|
| AtrA-g |
- |
Positive |
-142:-117 |
6939497..6939522 |
TGGCTGGAGGGGGCCGTTCCGGTCCT |
Hirano S, et al. (2008): GS, DB, FT
|
| Unknown_sigma |
ahpD-P1 |
Promoter |
-50:+10 |
6939589..6939648 |
GACAGCTTTACTTGGCCGTTGCCCGGATGTCCGGGTGCTACTATTCGCGAAGTGCGAAAG |
Distler J, et al. (1987): S1
Vujaklija D, et al. (1995): S1
|
| StrR |
- |
Positive |
ND |
ND |
ND |
Tomono A, et al. (2005): DB
|
| Comments:
|
| AtrA-g |
AtrA-g-disrupted strain produced smaller ammount of streptomycin than the wilde type in S. griseus. |
| Unknown_sigma |
Vujaklija D, et al. showed that A-factor directly binds between -430 to -330 bp upstream from the transcription start point of the strR gene. |
| StrR |
This gene expresses less in the strR-disrupted strain. (Direct or indirect regulation is not clear.) |
Terminator
No Data
Overview

|
|