Operon: No data
Promoters
| Unknown_sigma |
- |
Promoter |
-50:+10 |
CGGGTTCTCCGGAACTTTGAACTTGCGTTTCACACTGTGAGACGCAAGTATCGTTGCATG |
Santamarta I, et al. (2007): S1, PE, DB, GS, FT, HM, RT-PCR
|
S. clavuligerus |
| AreB |
- |
Positive |
-39:-26 |
GAACTTTGAACTTG |
Santamarta I, et al. (2007): S1, PE, DB, GS, FT, HM, RT-PCR
|
S. clavuligerus |
| Comments:
|
| Unknown_sigma |
S1 mapping was performed using 5'-carboxy?uorescein-labelled oligonucleotides leuC-O3 and areB-O11(Table 1), complementary to the 5'-coding regions of leuC and areB respectively. The areB tsp (transcription start point) was detected at a T located 7 bp upstream of the ATG start
codon. |
| AreB |
The purified rAreB protein protects a sequence extending from positions -39 to -26 with respect to the transcriptional start point of areB gene. The protected
region CAAGTTCAAAGTTC overlaps with the putative -35 region (AACTTT) for areB, and it is located 78 nt upstream of the calculated start point for leuC. |
Terminator
No Data
|
|