Transcription factor: AreB
| GenBank ID |
154425140 |
| Factor type |
ND |
| Pfam |
PF00392 (Bacterial regulatory proteins, gntR family
)
PF01614 (Bacterial transcriptional regulator
)
|
| Consensus seq. |
ND |
| Comment |
The areB gene, encoding this protein, is located upstream and in opposite orientation to the leuCD operon of S. clavuligerus; it encodes a 239-amino-acid protein of the IclR family with a helix-turn-helix motif at the N-terminal region. |
| ccaR |
None |
Negative |
-840:-815 |
GGAAAAACGTACCCCGGGGTCGGTTT |
Santamarta I, et al. (2005): HM, DP, GS
Santamarta I, et al. (2007): DB, GS, FT, HM, RT-PCR
|
S. clavuligerus |
| areB |
None |
Positive |
-39:-26 |
GAACTTTGAACTTG |
Santamarta I, et al. (2007): S1, PE, DB, GS, FT, HM, RT-PCR
|
S. clavuligerus |
| leuC |
None |
Positive |
-91:-78 |
CAAGTTCAAAGTTC |
Santamarta I, et al. (2007): S1, PE, DB, GS, FT, HM, RT-PCR
|
S. clavuligerus |
| brp |
None |
Positive |
-86:-61 (from translational start site) |
TGTCATTCAGACCCTTCGGTTTCTTT |
Santamarta I, et al. (2005): HM, DP, GS
Santamarta I, et al. (2007): S1, PE, DB, GS, FT, HM, RT-PCR
|
S. clavuligerus |
|