Operon: No data
Promoters
| Brp |
- |
Negative |
-86:-61 (from translational start site) |
TGTCATTCAGACCCTTCGGTTTCTTT |
Santamarta I, et al. (2005): HM, DP, GS
|
S. clavuligerus |
| AreB? |
- |
Positive |
-86:-61 (from translational start site) |
TGTCATTCAGACCCTTCGGTTTCTTT |
Santamarta I, et al. (2005): HM, DP, GS
Santamarta I, et al. (2007): S1, PE, DB, GS, FT, HM, RT-PCR
|
S. clavuligerus |
| Comments:
|
| Brp |
A brp gene, encoding a butyrolactone receptor protein, was cloned from S. clavuligerus. Sixty-one nucleotides upstream of brp another ARE sequence (ARE(brp)) was found, suggesting that Brp autoregulates its expression. Pure recombinant rBrp protein binds specifically to the ARE sequences present upstream of ccaR and brp. |
| AreB? |
Interestingly, a complete lack of amplification for the leuC gene from 24 h RNA samples was observed in the mutant (Fig. 6A, lane 8, upper panel). A similar result was found for the brp gene. However, the expression of both genes was observed at 48 h (Fig. 6A, lanes 5 and 8, lower panel), indicating that the deletion of areB delays, but does not prevent, expression of those genes. AreB plays a positive role on leuC and brp transcription. |
Terminator
No Data
|
|