Operons:
pimS2-S3-S4
Promoters
| Unknown_sigma |
- |
Promoter |
-50:+10 |
TGTGAGGAATCTAGGGAATTCCATGACAAACACCGTCGAAACTGGGCGAGTGGCGTGCGG |
Santos-Aberturas J, et al. (2011): HM, RACE
|
S. natalensis |
| PimM |
- |
Positive |
-44:-22 |
GAATCTAGGGAATTCCATGACAA |
Anton N, et al. (2007): DB, OV, RT-PCR
Santos-Aberturas J, et al. (2011): DP, GS, FT, HM, RACE
|
S. natalensis |
| Comments:
|
| Unknown_sigma |
To determine the transcriptional start sites of target promoters and to corroborate the monocistronic nature of some genes, such as pimJ and pimI, 5-RACE experiments were carried out. Once the -1 sites were known, the corresponding -10 and -35 boxes of each promoter were established by comparison with the matrices reported by Bourn and Babb (28) for Streptomyces that take into account the nucleotides occurring in 13-nucleotide
stretches, including the -10 or -35 consensus hexamers. |
| PimM |
GST-PimM binds directly to eight promoters of the pimaricin cluster, as demonstrated by electrophoretic
mobility shift assays. The binding regions of PimM-DBD were investigated by DNase I protection studies. In
all cases, binding took place covering the -35 hexamer box of each promoter, suggesting an interaction of PimM and RNA polymerase to cause transcription activation. Information content analysis of the 16 sequences protected in target promoters was used to deduce the structure of the PimM-binding site. This site displays dyad symmetry, spans 14 nucleotides, and adjusts to the consensus TVGGGAWWTCCCBA. |
Terminator
No Data
|
|