Transcription factor: SanG
| GenBank ID |
54288920 |
| Factor type |
ND |
| Pfam |
PF00486 (Transcriptional regulatory protein, C terminal
)
PF03704 (Bacterial transcriptional activator domain
)
|
| Consensus seq. |
ND |
| Comment |
SanG exhibits significant sequence similarity with PolR, PimR and PteR. All these proteins contain three major functional domains: an OmpR-like DNA-binding domain, a central ATPase domain with a potential ATP-binding motif and a C-terminal half homologous to the guanylate cyclase domain of the LuxR family. |
| sanO |
None |
Positive |
-46:-8 |
GCGGGGCAAGCGAGGCGGCGAGGTCCTTGCAGGGACGCG |
Liu G, et al. (2005): DB
He X, et al. (2010): GS, FT, SDM
Wang G, et al. (2003): PE
|
S. ansochromogenes |
| sanN |
None |
Positive |
-54:-23 |
GCCGGTCAGTGCACGGCAAGCCGTCGGCAAGG |
Liu G, et al. (2005): DB
He X, et al. (2010): GS, FT, SDM
Ling HB, et al. (2008): PE
|
S. ansochromogenes |
| sanN |
None |
Positive |
-54:-23 |
GCCGGTCAGTGCACGGCAAGCCGTCGGCAAGG |
Liu G, et al. (2005): DB
He X, et al. (2010): GS, FT, SDM
Ling HB, et al. (2008): PE
|
S. ansochromogenes |
|