Transcription factor: AbsC
| Gene ID |
SCO5405 (link to ScoCyc) |
| Factor type |
MarR-family |
| Pfam |
None |
| Consensus seq. |
ND |
| Comment |
Previous efforts to ?nd new regulators affecting antibiotic production have utilized DNA af?nity capture assay (DACA), which found a new MarR-like regulator(SCO5405) that is involved in both actinorhodin (ACT) and undecylprodigiosin (RED). This regulator has been separately named AbsC by another group. |
| aceE1 |
None |
Negative |
ND |
ND |
ND |
Yang YH, et al. (2010): DP, GS, RT-PCR
|
| aceE2 |
None |
Negative |
ND |
ND |
ND |
Yang YH, et al. (2010): DP, GS, RT-PCR
|
| SCO7681 |
None |
Negative |
8506174..8506212 |
None |
GATTATCATTTCTATAGTTCACATCGTAATCACACGACG |
Hesketh A, et al. (2009): AR, DB, FT, GS, OV, qRT-PCR
|
| SCO7682 |
None |
Negative |
8506180..8506219 |
-103:-64(from translation start site) |
GTGATTACGATGTGAACTATAGAAATGATAATCATTTCTA |
Hesketh A, et al. (2009): AR, DB, FT, GS, OV, qRT-PCR
|
|